Open Access
Add to BibSonomy
Abstract
A fluorescent biosensor E. coli/pTdcR-TurboYFP sensitive to terahertz (THz) radiation was developed via transformation of Escherichia coli (E. coli) cells with plasmid, in which the promotor of the tdcR gene controls the expression of yellow fluorescent protein TurboYFP. The biosensor was exposed to THz radiation in various vessels and nutrient media. The threshold and dynamics of fluorescence were found to depend on irradiation conditions. Heat shock or chemical stress yielded the absence of fluorescence induction. The biosensor is applicable to studying influence of THz radiation on the activity of tdcR promotor that is involved in the transport and metabolism of threonine and serine in E. coli.
© 2021 Optical Society of America under the terms of the OSA Open Access Publishing Agreement
1. Introduction
THz radiation is represented by electromagnetic waves in the frequency range of 1011–1013 Hz (wavelengths from 30 μm to 3 mm) located between the infrared and microwave regions of the electromagnetic spectrum [1]. The spheres of THz science and technology are relatively new and demonstrate a rapid progress over last years, finding applications in such areas as telecommunications, security screening, molecular spectroscopy, nondestructive testing, and medical diagnosis and therapies [2–5]. It is worth noting that the issue of biosafety of THz technologies raises a question of the impact of THz radiation on living entities.
The THz frequencies correspond to rotational and vibrational modes of many biomolecules in living systems, e.g., nucleic acids and proteins [6–9]. THz modes are also typical for stand-alone water molecules and water clusters, which exert a direct influence on the structure, stability, and dynamics of biomolecules [10,11]. This may be a reason for substantial nonthermal effects of this type of radiation, as demonstrated in various biological models: biomolecules, cells, tissues, and multicellular organisms [12,13].
In certain cases, THz radiation affects the cellular genetic apparatus. Although most studies have not revealed adverse effects [14–16], some experiments have shown controversial results [17–19]. In particular, the ability of THz waves to induce aneuploidy has been demonstrated in [17,19] using characteristic signs: appearance of spindle disturbances, an increase in the frequency of centromere-positive micronuclei, and chromosomal nondisjunction. In another study [18], DNA damage (according to the induction of histone H2AX phosphorylation) and activation of DNA damage repair mechanisms (according to an increase in the levels of several characteristic proteins) were identified.
A response of a living system to THz radiation is specific and strongly depends both on parameters of the exposure and on the state of the living entity itself. This notion has been best demonstrated in studies of various cell types in which gene activity has been evaluated, including whole-genome gene expression profiling [20]. THz waves selectively influences the expression level of some genes or groups of genes, thereby forming unique patterns of differential gene expression that are different from those for other stressors, such as hyperthermia [21–23], ultraviolet irradiation [21,24], and neutron irradiation [21]. Of particular importance is the non-thermal nature of the THz influence, for which there is a sufficient amount of experimental evidence [21–27]. In general, obtaining the experimental data is accompanied by the development of a theoretical basis to explain the high sensitivity and selectivity of the effect of THz radiation on DNA [28–30].
In the present study, we developed a fluorescent microbial biosensor for evaluation of nonthermal effects of THz radiation on a biological system. In general, a fluorescent microbial biosensor is a genetically engineered microorganism harboring an artificial genetic construct that combines an inducible promoter with a reporter gene. The latter encodes a fluorescent protein that can emit detectable fluorescence in the cell, and the emitted light is proportional to the analyte concentration within a certain range [31,32]. The important advantages of the biosensor technology are the possibility of intravital analysis of changes in gene activity in cells (including individual cells) and monitoring of these alterations in real time. The maturity of this technology is evidenced by the creation of a comprehensive library of constructs with fusions of the gene encoding green fluorescent protein (GFP) to each of ∼2000 different promotors from the E. coli genome [33]. Fluorescent microbial biosensors have been devised that react to certain substances: ions of toxic metals [34,35], arsenic [36,37], various genotoxic agents [38–41], inducers of oxidative stress [38,40,41], hydrogen ions (pH) [42], and others. For electromagnetic radiation, a bioluminescent microbial biosensor is available, which is a strain of the luminescent bacterium Photobacterium leiognathi highly sensitive to weak nonthermal radiation of 42 GHz frequency [43].
Studies on the impact of THz radiation on the cellular genetic apparatus by means of fluorescent biosensors based on E. coli cells are actively conducted by our research group.
Earlier, under pulsed irradiation by the Novosibirsk Free Electron Laser (NovoFEL) (Budker Institute of Nuclear Physics of the Siberian Branch of the Russian Academy of Sciences (SB RAS), Novosibirsk, Russia) at a frequency of 2.31 THz and average power density ∼0.14 W/cm2, we have studied time-dependent alterations in promoter activity of the following genes: catalase katG [44,45], copper chaperone copA, and multidrug resistance regulator emrR [45]. In all cases, as a reporter, GFP has been employed. The induction of biosensors involving inducible promoters of genes katG and copA has been demonstrated, whereas a biosensor containing the inducible emrR promoter has not been activated [44,45]. Additionally, using the biosensor with the inducible promoter of katG, we have shown the induction at frequencies of 1.50 and 2.00 THz [44].
Later, we have developed three THz-sensitive biosensors to investigate promoter activity of the following genes: matA that is associated with bacterial biofilm formation, safA that is involved in the cellular response to various types of stress, and chbB that participates in the uptake and metabolism of chitobiose [46]. As a reporter, fluorescent protein TurboGFP or TurboYFP has been employed. The biosensors were exposed to high-intensity pulsed 2.31 THz radiation (average power density ∼0.14 W/cm2) from NovoFEL mentioned above, and to low-intensity continuous 0.14 THz radiation (average power density ∼2 mW/cm2) from a semiconductor-diode-based device. The threshold and dynamics of fluorescence were found to depend on radiation parameters and exposure time.
Thus, using E. coli fluorescent biosensors, we have previously conducted the intravital assessment of the activity of genetic networks responsible for various cellular functions, under conditions of exposure to THz radiation with different parameters.
The development of new biosensors of this type is highly relevant, primarily for scientific purposes. In this study, during the selection of an inducible promoter for the construction of a THz-sensitive hybrid genetic construct, we considered promoters of transcription factor (TF) genes, as in [46], because they encode proteins that usually modulate the activity of a set of genes within one or several operons [47]. Accordingly, the construction of the biosensor with an inducible promoter of a TF gene makes it possible to investigate a whole group of metabolically linked genes that are regulated by this TF in the E. coli genome. Meanwhile, under the conditions of THz irradiation, the induction (fluorescence) of biosensor cells reflects the influence of the radiation on a specific metabolic process associated with the activity of these genes.
The main aims of this work were as follows: 1) to develop a THz-sensitive fluorescent E. coli biosensor with the inducible promoter of the TF gene which represents a specific cellular function (metabolic process); 2) to investigate THz-driven induction of the obtained biosensor under conditions of various physical parameters of THz radiation, geometry of the irradiated container with cells, and composition of the nutrient medium.
2. Materials and methods
2.1 Construction of the biosensor pTdcR-TurboYFP plasmid
The construction was carried out in two stages: preparation of the necessary DNA fragments and their joining by the Gibson method.
As a basic vector, plasmid pTurboYFP-B (Evrogen, Russia) was used [48], which contains the gene encoding the TurboYFP protein (an enhanced version of yellow fluorescent protein PhiYFP from the medusa Phialidium sp. [49]) under the control of the T5 promoter/lac operator element (consists of the phage T5 promoter and two lac operator sequences), and the gene of ampicillin resistance.
DNA Fragment 1, containing the structural gene of TurboYFP, was amplified from the basic pTurboYFP-B vector by PCR with the following primers: forward — 5′-atgagcagcggcgcc, reverse — 5′-tttctcgaggtgaagacgaaagg. The reaction was carried out by means of the High Fidelity PCR Kit (New England Biolabs, UK) according to the manufacturer’s protocol. Then, to remove the original plasmid, the reaction mixture was purified by means of the MalI restriction enzyme (SibEnzyme, Russia). The resultant linear 4017 bp DNA fragment lacked only the region of the T5 promoter/lac operator element in comparison with the basic vector.
To prepare DNA Fragment 2, containing the tdcR promoter, genomic DNA was isolated from cells of E. coli strain JM109 via the diaGene Kit for Isolation of Genomic DNA from Bacterial Cells (Dia-M, Russia) according to the manufacturer’s protocol. DNA Fragment 2 was amplified from the genomic DNA with the same PCR kit (see above) and the following primers: forward — 5′-cctttcgtcttcacctcgagaaatcaatactttccagagtatcgttattacaat, reverse — 5′-ggcgccgctgctcattaaatttaactcaaattttgcctggtaattatcc. The resultant 264 bp DNA fragment contained 5′ overhangs complementary to the 5′ ends of DNA Fragment 1.
The length of the obtained DNA fragments was roughly verified by 1% agarose gel electrophoresis and ethidium bromide staining. Next, the fragments were joined by the Gibson method [50] by means of the kit Gibson Assembly Master Mix (New England Biolabs, UK) according to the manufacturer’s protocol.
2.2 Creation of the E. coli/pTdcR-TurboYFP biosensor cells
The biosensor cells were obtained via transformation of E. coli cells with the pTdcR-TurboYFP plasmid by electroporation.
First, electrocompetent E. coli strain JM109 cells were prepared. To this end, the cells were grown in the Lysogeny broth (LB) medium (1% (w/v) of tryptone, 0.5% (w/v) of yeast extract, 171 mM NaCl, pH 8.0) until OD600 (optical density at 600 nm wavelength, assuming 1 cm path length) reached 0.6. Then, the cells were cooled to 4 °С, washed with water, and resuspended in 10% aqueous glycerol.
Second, the bacterial-cell transformation was performed. For this purpose, the electrocompetent cells and the pTdcR-TurboYFP plasmid were mixed, and electroporation was conducted in the Gene Pulser Cuvette with a gap width of 1 mm (Bio-Rad, USA) on Gene Pulser Xcell (Bio-Rad, USA) via the standard preset protocol for bacterial cells. The transformants were selected on the LB agar medium (LB medium supplemented with 1.5% (w/v) of agar-agar) containing100 µg/mL ampicillin.
Third, in colonies that grew under the selection pressure, correctness of the construction of plasmid pTdcR-TurboYFP was assessed by DNA sequencing. To this end, cells from the Petri dishes were transferred onto the LB medium containing 100 µg/mL ampicillin, were grown overnight, and were subjected to plasmid DNA isolation by means of the diaGene Kit for Isolation of Plasmid DNA (Dia-M, Russia) according to the manufacturer’s protocol. The DNA sequence covering the border between the promoter region of the tdcR gene and the TurboYFP structural gene was amplified by PCR and analyzed by means of the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific, USA) according to the manufacturer’s protocol, on an ABI Prism 3100 Avant Genetic Analyzer (Applied Biosystems, USA).
2.3 Exposure of the biosensor cells to THz radiation from the NovoFEL source
E. coli/pTdcR-TurboYFP cells were seeded from frozen aliquots on the LB medium containing 100 µg/mL ampicillin and were grown overnight, reseeded on an identical fresh medium with the antibiotic, and were grown until OD600 of 0.5 for ∼2.5 h (37 °С, 250 rpm). After that, the cells were washed and transferred onto a fresh medium with the antibiotic, where they were irradiated and analyzed. At this stage, one of two nutrient media was employed: LB or M9 (48 mM Na2HPO4, 22 mM KH2PO4, 18.7 mM NH4Cl, 8.5 mM NaCl, pH 7.5; additional ingredients: 1 mM MgSO4, 0.1 mM CaCl2, 44 mM glucose, and 0.2% of casamino acids).
The radiation source was the NovoFEL facility at the Siberian Synchrotron and Terahertz Radiation Centre (Budker Institute of Nuclear Physics, SB RAS, Novosibirsk, Russia). The part of the facility called “the first stage” was used; it provides pulsed THz radiation with general characteristics summarized in Table S1 in Supplement 1 [51].
On a specialized workstation (Fig. 1(a)), irradiation of 50 μL of the cultured biosensor cells was conducted in two types of vessels: in a well of a standard 96-well flat-bottom polystyrene microplate (Costar-3599, Corning, USA; Fig. 1(b)), covered with THz-transparent 40-µm-thick polypropylene film, or in a specially designed 60-mm-diameter cuvette that was made of two THz-transparent 40-µm-thick polypropylene membranes stretched onto metallic rings (Fig. 1(c)). In the former case, the cell culture was dispensed into nine wells having a square shape (3 wells × 3 wells measuring 2.6 cm × 2.6 cm). In the well, thickness of the liquid layer and geometry of the irradiated surface were determined by coryphosphine staining of the medium and confocal laser scanning microscopy under an LSM 780 microscope (Zeiss, Germany).
Fig. 1. Conditions for irradiation of cell samples: the outline of the experimental workstation (irradiation in the cuvette as an example) (a), and photographs (top view) of the 96-well microplate (b) and of the cuvette (c).
The samples were irradiated from above. The diameter (full width at half maximum of intensity) of the radiation Gaussian beam in the plane of the sample was ∼30 mm (σ ≈ 13 mm). To ensure more even exposure, the microplate or cuvette was rotated using a special rotating table so that the rotation axis and the beam center were offset relative to each other. Due to the thermal effect of THz radiation, the samples got heated during the irradiation. This process was controlled by means of a TKVr-SVIT101 thermal imager (Rzhanov Institute of Semiconductor Physics SB RAS, Novosibirsk, Russia) with 0.03 °C accuracy [52]. The power of incident radiation and consequent heating of the samples were restricted by adjusting the aperture of an obturator. The obturator consisted of two 25-cm-diameter closely spaced copper disks that had two sector apertures and a common rotational axis, with the rotation being driven by an electric motor. By rotating the disks relative to each other, one could change the average power for the transmitted radiation. An IMO-4 detector (experimental factory Etalon, Volgograd, Russia) was used to measure the average radiation power (in the plane of the sample) corresponding to heating of the sample to 35–37 °C.
In total, the THz exposure conditions were as follows: frequency 2.31 THz, pulse repetition rate 5.6 MHz, pulse duration 100 ps, average power density either ∼0.18 W/cm2 (in the microplate) or ∼0.14 W/cm2 (in the cuvette), irradiation heating of samples to 35–37 °С, and duration of treatment 15 or 30 min. In parallel, control cells were incubated in an identical vessel in an air thermostat at 37 °С for the same period.
Additionally, sham experiments were conducted: under identical conditions of irradiation and fluorescence quantitation, we analyzed E. coli strain JM109 cells transformed with the basic pTurboYFP-B vector.
2.4 Exposure of the biosensor cells to THz radiation from the TeraSense source
In addition to the experiments at the NovoFEL facility, we carried out investigations using a second source of THz radiation which was represented by a low-frequency low-intensity table-top solid-state device based on an IMPATT-diode (IMPact ionization Avalanche Transit-Time diode) produced by Terasense Group Inc., USA. This source ensured coherent continuous-wave emission of THz radiation at a frequency of 0.14 THz with output power of 44 mW [53]. The cultured biosensor cells were prepared in the same way as in the NovoFEL experiments and were irradiated in the stationary cuvette with a 50 µL volume in the LB medium. The diameter (full width at half maximum of intensity) of the quasi-Gaussian radiation beam in the plane of the sample was measured to be ∼30 mm. A more detailed description of the experimental setup is presented in our previous work [46].
In total, the THz exposure conditions were as follows: frequency 0.14 THz, average power density ∼2 mW/cm2, and treatment duration 15 or 30 min; the heating of the sample during the THz exposure was negligible and did not exceed room temperature (∼26 °С) by more than 1 °С. In parallel, control cells were incubated in an identical cuvette at room temperature for the same period.
2.5 Fluorescence analysis of the irradiated biosensor cells
After the irradiation, all the samples were transferred into a microplate (identical to the one used for irradiation), and fluorescence was measured on a VICTOR X3 2030 microplate reader (Perkin Elmer, USA) at the following settings: excitation wavelength 485 nm, emission wavelength 535 nm, and duration of irradiation by exciting light 0.1 s. The measurements were carried out for up to 4.5 h after the end of THz exposure, with signal acquisition at 30 min intervals; during the intervals, the samples were incubated at 37 °С and 800 rpm. In case of the irradiation by NovoFEL, the first measurement was carried out 30 minutes after the end of the irradiation.
2.6 Exposure of the biosensor cells to an elevated temperature or chemical stressors
The biosensor cells in the LB or M9 medium were prepared in the same way as in the THz irradiation procedure.
During the heat shock experiment, the cultured cells were dispensed into wells of the 96-well microplate at 50 μL/well. The microplates with experimental and control samples were incubated in the air thermostat at 42 and 37 °С, respectively, for 30 min.
In the experiment on chemical induction (exposure to hydrogen peroxide, phenol, salicylic acid, Cu(II) sulfate, or Fe(III) chloride), the cultured cells were concentrated 1.1-fold and dispensed into wells of the microplate at 45 µL/well. Five microliters of a nutrient medium with or without a chemical agent was added to the experimental and control samples, respectively. The agents were added in the following ranges of final concentrations (serial 2-fold dilutions): 0.156–40.000 mM for hydrogen peroxide and phenol, 0.005–1.250 mM for salicylic acid, and 0.6–156.0 μM for Cu(II) sulfate and Fe(III) chloride.
After the thermal or chemical stress, the fluorescence was measured similarly to the THz experiments.
2.7 Assessment of the growth dynamics of the irradiated biosensor cells
The cells were incubated and irradiated in the same way as in the main THz experiments. In wells of an identical 96-well microplate, OD600 of irradiated and control samples was measured every 30 min during the whole incubation period (9 h) on an Epoch microplate spectrophotometer (BioTek, USA).
2.8 Statistical analysis
Every type of experiment with THz irradiation and the experiments with the elevated temperature or chemical stressors were implemented in six independent (biological) replicates. After irradiation of the biosensor in wells of the microplate, we determined average fluorescence of the wells (which were considered technical replicates) inside each biological replicate. Data from the fluorescence curves were subjected to linear regression analysis. For each paired group (inside each biological replicate), slope coefficients were calculated in an experiment and control, and significance of their differences according to the sum of all biological replicates (n = 6) was evaluated by nonparametric Wilcoxon’s paired rank sum test. To plot averaged normalized induction levels, in each paired group (inside each biological replicate), we computed a ratio of fluorescence intensity in an experiment to that in the control at a given time point of fluorescence measurement and performed averaging of all biological replicates (n = 6). All the calculations were carried out in Statistica 10 software (StatSoft, USA).
3. Results
3.1 E. coli/pTdcR-TurboYFP biosensor
Previously, after irradiating E. coli strain JM109 cells in the LB medium at the NovoFEL facility, by genome-wide RNA sequencing screening, we have identified seven TF genes significantly overexpressed (log2 fold change ≥1, P < 0.05) under THz irradiation: cadC, caiF, chbR, gadW, matA, tdcR, and ydeO [54]. In that study, the tdcR gene manifested the highest upregulation (log2 fold change 3.33), and its promoter was chosen as an inducible promoter for the development of the THz-sensitive biosensor in the current study.
Here, we created DNA construct pTdcR-TurboYFP, in which the tdcR promoter controls the production of yellow fluorescent protein TurboYFP. By transforming E. coli strain JM109 cells with this plasmid, we obtained the biosensor E. coli/pTdcR-TurboYFP whose induction was tested under various conditions: THz irradiation, heat shock, and chemical stress.
3.2 Response of the biosensor cells to THz radiation
The main experiments with THz irradiation were performed at the NovoFEL facility. The biosensor E. coli/pTdcR-TurboYFP showed induction under the irradiation, resulting in the production of the TurboYFP protein by the cells. Nonetheless, the induction did not take place in all cases and showed varied dynamics.
For the THz exposure, cultured cells were placed in two types of vessels. In the first case, a 50 μL sample was irradiated in a well of a 96-well microplate. The sample in the well of the microplate took the shape of a 6.4-mm-diameter round horizontal layer with approximate thickness between 0.8 mm (in the center) and 1.6 mm (at the edges). The area of the irradiated surface was ∼36.5 mm2.
The second type of vessel was employed to maximize the ratio of irradiated surface area to sample volume: a 50 μL sample was irradiated in a specially designed cuvette. The sample in the cuvette took the shape of a 40-mm-diameter 40-µm-thick round horizontal layer. The irradiated surface area was ∼1257 mm2.
The irradiation was performed for 15 or 30 min in one of the two nutrient media: the nutrient-rich LB medium or minimal medium M9 with additives. Given that the nutrient media at our optical parameters of detection have their own fluorescence (substantial for LB and weak for M9), all the presented data and their comparative analysis take into account the background fluorescence resulting from the nutrient media (this background was subtracted).
The difference in the biosensor cells’ fluorescence dynamics between the two nutrient media is illustrated in a graph (with 30 min irradiation in the cuvette as an example; Fig. 2), reflecting the results from a single biological replicate of each group. In the other five replicates, induction of the biosensor was similar: fluorescence increased for all 4 h in the LB medium, but this increase was only transient in the M9 medium. These fluorescence dynamics were taken into account in subsequent calculations.
Fig. 2. Typical dynamics of the biosensor cells’ fluorescence in response to 30 min THz irradiation by the NovoFEL source in the cuvette in the two nutrient media (LB or M9) in comparison with a control (bulk heating). Results of one independent replicate are presented — fluorescence curves and the respective linear regression equations. *Equations correspond to M9 medium and a period up to a 1.5 h time point only.
In each biological replicate, in the experiment and control, average slope coefficients were calculated in the slope analysis during the 4 h of measurements for the LB medium and 1 h of measurements for the M9 medium. Accordingly, to plot the normalized induction levels, we utilized fluorescence values at 4.5 and 1.5 h after irradiation. These processed data are presented in histograms (Figs. 3 and 4).
Fig. 3. Normalized induction levels of the biosensor cells (average values from six biological replicates) in response to THz irradiation by NovoFEL source in the LB medium, at 4.5 h after the exposure: in the microplate (a) and in the cuvette (b). The error bars represent standard deviation; bexp and bcont are average slope coefficients in experiment and control, respectively. *Significant differences (P < 0.05) in slope coefficients between experiment and control.
According to Fig. 3, in the LB medium in the microplate after irradiation for 15 min, there was induction of the biosensor, and this effect noticeably increased after 30 min treatment. In the cuvette, the induction occurred only after 30 min THz exposure of the cells. Figure 4 indicates that in the M9 medium, biosensor induction took place only in the cuvette after irradiation for 30 min.
Fig. 4. Normalized induction levels of the biosensor cells (average values from six biological replicates) in response to THz irradiation by NovoFEL source in the M9 medium, at 1.5 h after the exposure: in the microplate (a) and in the cuvette (b). The error bars represent standard deviation; bexp and bcont are average slope coefficients in experiment and control, respectively. *Significant differences (P < 0.05) in slope coefficients between experiment and control.
In sham experiments, namely, after the same kind of THz irradiation of E. coli cells harboring basic plasmid pTurboYFP-B (which does not contain the THz-sensitive inducible promoter), the fluorescence response was undetectable (Fig. S1 in Supplement 1).
In addition to the main experiments, the biosensor cells were irradiated by the TeraSense source with radiation parameters different from those of the NovoFEL. The biosensor E. coli/pTdcR-TurboYFP was irradiated in the cuvette in the LB medium and showed induction under these conditions (Fig. 5). This induction took place at both 15 and 30 minutes of irradiation.
In the sham experiments, the fluorescence response was undetectable, as was shown in our previous work [46].
Fig. 5. Induction of the biosensor cells in response to THz irradiation by the TeraSense source in the cuvette in the LB medium: typical dynamics of the fluorescence in response to 30 min THz irradiation in comparison with a control (results of one independent replicate are presented — fluorescence curves and the respective linear regression equations) (a); normalized induction levels (average values from six biological replicates) at 4.5 h after the exposure (b). The error bars represent standard deviation; bexp and bcont are average slope coefficients in experiment and control, respectively. *Significant differences (P < 0.05) in slope coefficients between experiment and control.
3.3 Response of the biosensor cells to an elevated temperature or chemical stressors
After the biosensor cells were heat-shocked (heating at 42 °С for 30 min) or exposed to a chemical stressor (hydrogen peroxide, phenol, salicylic acid, Cu(II) sulfate, or Fe(III) chloride), in all the studied concentration ranges, biosensor induction was not noted in either the LB medium or M9 medium (Fig. S2 and S3 in Supplement 1).
3.4 Growth dynamics of the biosensor cells
Growth dynamics of the cultured biosensor cells were determined from changes in OD600. The THz irradiation, under the various exposure conditions, did not affect the growth dynamics. On the contrary, bacterial culture growth depended on the nutrient medium onto which the cells were transferred at ∼2.5 h after cell seeding (Fig. 6).
Fig. 6. Typical growth dynamics of the biosensor cells in nutrient medium LB or M9 (incubation in wells of the 96-well microplate). In both cases, the cells were grown in the LB medium until OD600 of 0.5.
4. Discussion
The creation of the biosensor E. coli/pTdcR-TurboYFP and its testing are a continuation of our series of studies on the effects of THz radiation on the cellular system of gene expression by means of bacterial fluorescent biosensors. In biosensors E. coli/pKatG-GFP, E. coli/pCopA-GFP, and E. coli/pEmrR-GFP, we have previously studied promoters of genes katG, copA, and emrR [44,45,55]. Recently, in biosensors E. coli/pMatA-TurboGFP, E. coli/pSafA-TurboGFP, and E. coli/pChbB-TurboYFP, we have studied promoters of genes matA, safA, and chbB [46]. All mentioned promoters except that of emrR react to THz radiation, thereby reflecting participation of the corresponding genetic systems in the cell response to this stimulus.
In this study, we developed a biosensor with the THz-sensitive inducible promoter of the tdcR gene. We found that the selected TF gene, tdcR, is strongly upregulated under THz irradiation. Besides, it regulates a relatively small group of specialized functions in the cell. These characteristics are important for ensuring high sensitivity and specificity of the obtained biosensor, E. coli/pTdcR-TurboYFP.
During the evaluation of fluorescent activity of the biosensor E. coli/pTdcR-TurboYFP under the influence of THz radiation, in most experiments, we noted its induction, which varied and depended on specific conditions (Figs. 2–5). Additional testing was performed as well. First, under THz irradiation in analogous settings, E. coli cells carrying basic plasmid pTurboYFP-B (without the tdcR promoter) did not manifest a fluorescent response (Fig. S1 in Supplement 1, and the results in our previous work [46]). This finding supports the notion that THz-induced TurboYFP protein expression in the pTdcR-TurboYFP plasmid occurred precisely because of the activation of the tdcR promoter. Second, after the exposure to heat shock or chemical stressors, the induction of the obtained biosensor was not detectable (Figs. S2 and S3 in Supplement 1). These results indicate specificity of the induction of the biosensor E. coli/pTdcR-TurboYFP by THz radiation, within the range of investigated conditions.
Irradiation by the NovoFEL source for different periods (15 and 30 min) induced the biosensor differently (Figs. 3 and 4). Overall, after the irradiation for 30 min, the fluorescent response was more pronounced, whereas after 15 min, it was often completely undetectable. This finding illustrates the threshold nature of this biosensor’s induction.
In the NovoFEL experiments, two types of vessels were utilized, in which we placed a sample of a biosensor cell culture during the irradiation. With the fixed sample volume (50 μL), these vessels yielded substantially different conditions of THz exposure. First of all, the ratio of irradiated surface area to sample volume diverged greatly between the vessels. For a well of the microplate and for the cuvette, this ratio was approximately 25 and 0.7, respectively. Second, minimal thickness of the irradiated sample differed 20-fold: ∼800 and 40 μm, respectively, for the microplate well and for the cuvette. This property is important because of the strong absorption of THz radiation by the water-based sample. For example, in a 100 µm layer of water (whose absorption characteristics are roughly similar to those of cells in a nutrient medium), absorption of THz radiation at the studied frequency of 2.31 THz is more than 98% [56]. Accordingly, the use of the cuvette enabled exposure of the cell suspension throughout its whole volume, whereas during irradiation in the microplate, only the surface layer was exposed. Because in the latter case, we increased average radiation power only slightly (from 0.14 to 0.18 W/cm2, which was necessary to maintain sample temperature in the range 35–37 °С), the aforementioned facts ensured a substantially lower absorbed dose during the irradiation in the microplate as compared to the cuvette. Nevertheless, induction of the biosensor was seen in both cases, and the magnitude correlated with the type of nutrient medium (Figs. 3 and 4). Although the high absorption coefficient of water limits THz wave penetration depth, it does not impose severe restrictions on energy transport in water induced by THz irradiation. For example, it has been reported that the energy of THz pulse radiation can propagate more than 1000 μm into an aqueous solution according to the results of demolition of cellular actin filaments [27]. The authors interpreted this effect using THz-induced shockwave propagation and visualized such shockwaves in distilled-water samples. In our study, we do not rule out a similar effect of THz pulse radiation.
In the NovoFEL experiments, cells of the biosensor E. coli/pTdcR-TurboYFP were irradiated in two standard microbiological media: the nutrient-rich LB medium and so-called M9 Minimal Salts (additionally supplemented with MgSO4, CaCl2, glucose, and casamino acids). Growth dynamics of the cells were substantially dissimilar between LB and M9 (Fig. 6). From Fig. 6, it follows that the irradiation (just as heat shock or chemical stress) was implemented at the beginning of the exponential growth phase (at ∼2.5 h after cell seeding). Moreover, the cells showed rapid growth during most of the post-treatment period when the fluorescence measurements for 4 h were performed. In both media, the THz irradiation did not affect the growth dynamics. Therefore, the THz radiation did not affect cell survival either.
The use of different media turned out to be important for the formation of a response to irradiation, both in terms of the fluorescent-response dynamics and in terms of the threshold for response triggering. In the LB medium, the induction was much greater, lasted during the whole analyzed period (up to 4.5 h), and was detected in both types of vessels (Figs. 2 and 3). In the M9 medium, the induction was very weak, lasted only during the first 1.5 h of the analyzed period, and was seen only in the experiment with the highest absorbed dose, i.e. in the cuvette after 30 min irradiation (Figs. 2 and 4). The difference in nutrient-medium composition affects the growth and metabolism of bacteria. In this study, LB and the version of the M9 medium being used differed substantially from each other in such parameters as the carbon source and salt contents, and these parameters play a crucial role in metabolism, gene expression, and cell signaling of E. coli [57]. This notion was also illustrated by differences in growth dynamics (Fig. 6). Therefore, the nutrient-medium-dependent activation of the tdcR gene promoter, when other THz exposure conditions were identical, was not surprising. At the same time, the more pronounced biosensor induction in the LB medium than in the M9 medium is consistent with our previous RNA sequencing results; these data revealed that the activation of the tdcR gene was also obtained on the LB medium [54].
In addition to the experiments at the NovoFEL facility, cells of the biosensor E. coli/pTdcR-TurboYFP were irradiated in the cuvette in the LB medium by the semiconductor-diode-based source. In this case, the cells were exposed to THz radiation with physical characteristics substantially different from those of the NovoFEL source, including a 70-fold lower average intensity (∼2 vs. ∼140 mW/cm2). The induction under these conditions was also observed (Fig. 5), but it had different features in comparison with that under NovoFEL irradiation (also in the cuvette in the LB medium): in particular, when the cells were exposed to radiation from TeraSense source for 15 min, the effect appeared (Figs. 5(b)). Thus, first of all, the biosensor was proven to respond to THz radiation with very different physical parameters: the high-intensity pulsed short-wave (2.31 THz) and the low-intensity continuous long-wave (0.14 THz) radiation. Second, the induction of the biosensor (i.e. the activity of the tdcR gene promoter) was sensitive to these parameters. This observation is consistent with the results of other studies, which revealed changes in specific activation or repression of certain genes under conditions of changes in one or another characteristic of THz radiation: intensity [18,24], frequency [58], operation regime and frequency spectrum [59]. In our case, there is no definitive answer to the question which of the radiation parameters is of primary importance for the observed differences in the induction of the biosensor.
In total, both for the NovoFEL and TeraSense sources it was demonstrated a dose-dependent nature of the THz-stimulated induction. For some experiments, as noted above, it had the threshold behavior: the effect was not revealed at 15 min irradiation, in contrast to 30 min exposure (Figs. 3(b) and 4(b)).
Sensitivity and specificity of the biosensor E. coli/pTdcR-TurboYFP to THz radiation is mostly determined by the THz-sensitive tdcR promoter. In the E. coli genome, tdcR is a weakly expressed regulatory gene taking part in amino acid metabolism. It encodes a specific DNA-binding trans-acting positive activator of the biodegradative threonine dehydratase (tdc) operon, which contains several genes involved in the transport and metabolism of threonine and serine during anaerobic growth [60,61]. The TdcR protein functions together with the product of the first gene in the operon (specific transcriptional regulator TdcA) and with two nonspecific regulators: catabolite gene activator protein (CAP) and integration host factor (IHF) [62–64]. The regulation of the tdc operon is indirectly mediated by two global transcriptional regulators: FNR (fumarate and nitrate reductase activator) and ArcA (a member of the two-component ArcBA sensor–regulator system) [65]. In turn, the FNR and ArcBA global regulatory systems together with the SoxRS and OxyR systems are involved in the adaptation of E. coli to aerobic environments. The katG promoter, which we have previously evaluated as a component of a biosensor [38,44,45], and which is also responsive to THz radiation, is directly related to these regulatory systems because it is straightforwardly activated by OxyR proteins [66] and possibly by FNR [67].
The tdcR gene plays a part in serine metabolism, and serine is a signaling molecule in E. coli. Acylated lactones of homoserine in gram-negative bacteria serve as autoinducers of quorum sensing. Appearance of serine in the medium within several hundred milliseconds causes chemotaxis and movement of E. coli cells in this direction [68], thereby leading to their aggregation, which is typical behavior under stressful conditions [69]. Activation of the tdcR gene under the influence of THz radiation suggests that during THz irradiation, E. coli cells experience stress and launch stress response systems.
5. Conclusion
On the basis of the tdcR promoter, a THz-sensitive fluorescent bacterial biosensor, E. coli/pTdcR-TurboYFP, was created, which serves as a tool for studying tdcR promoter activity in E. coli cells. Induction of the newly developed biosensor was investigated under THz irradiation and under other conditions, and the main results can be summarized in these bullet points:
- • The biosensor showed induction under the impact of THz radiation with different physical parameters.
- • In comparison with the heat or chemical stressors tested, induction of the biosensor was specific to THz radiation.
- • The induction was dose-dependent: the effect appeared or intensified with increasing irradiation duration from 15 to 30 min.
- • Characteristics of the biosensor induction depended on physical parameters of THz radiation, on the type of vessel for irradiation, and on composition of the nutrient medium.
The biosensor E. coli/pTdcR-TurboYFP can be useful for static or dynamic and qualitative or quantitative intravital assessment of tdcR gene expression in E. coli cells. This biosensor may be helpful for the research into the influence of THz radiation on a living system and in other fields that require analysis of the activity of the tdcR gene promoter. Further investigation of E. coli/pTdcR-TurboYFP induction involving a variation in THz radiation characteristics is needed to better assess the limits of application of this tool.
Funding
Ministry of Science and Higher Education of the Russian Federation (0259-2021-0010, 075-15-2019-1662).
Acknowledgments
The irradiation experiments were conducted on the Novosibirsk Free Electron Laser at the Siberian Synchrotron and Terahertz Radiation Centre of Budker Institute of Nuclear Physics SB RAS (Novosibirsk, Russia). The authors also acknowledge the Shared Equipment Center CKP “VTAN” (ATRC, Physics Department) of Novosibirsk State University (Novosibirsk, Russia) for the provided instrumental support. The microscopic analysis was carried out at the Microscopy Center of Federal research center Institute of Cytology and Genetics SB RAS (Novosibirsk, Russia). The creation of the biosensors and their testing were carried out, respectively, at the Laboratory of Molecular Biotechnologies and the Kurchatov Genomics Center of Federal research center Institute of Cytology and Genetics SB RAS (Novosibirsk, Russia).
Disclosures
The authors declare no conflicts of interest.
See Supplement 1 for supporting content.
References
1. S. Romanenko, R. Begley, A. R. Harvey, L. Hool, and V. P. Wallace, “The interaction between electromagnetic fields at megahertz, gigahertz and terahertz frequencies with cells, tissues and organisms: risks and potential,” J. R. Soc., Interface 14(137), 20170585 (2017). [CrossRef]
2. S. S. Dhillon, M. S. Vitiello, E. H. Linfield, A. G. Davies, M. C. Hoffmann, J. Booske, C. Paoloni, M. Gensch, P. Weightman, G. P. Williams, E. Castro-Camus, D. R. S. Cumming, F. Simoens, I. Escorcia-Carranza, J. Grant, S. Lucyszyn, M. Kuwata-Gonokami, K. Konishi, M. Koch, C. A. Schmuttermaer, T. L. Cocker, R. Huber, A. G. Markelz, Z. D. Taylor, V. P. Wallace, J. A. Zeitler, J. Sibik, T. M. Korter, B. Ellison, S. Rea, P. Goldsmith, K. B. Cooper, R. Appleby, D. Pardo, P. G. Huggard, V. Krozer, H. Shams, M. Fice, C. Renaud, A. Seeds, A. Stohr, M. Naftaly, N. M. Ridler, R. Clarke, J. E. Cunningham, and M. B. Johnston, “The 2017 terahertz science and technology roadmap,” J. Phys. D: Appl. Phys. 50(4), 043001 (2017). [CrossRef]
3. F. F. Sizov, “Infrared and terahertz in biomedicine,” Semicond. Phys. Quantum Electron. 20(3), 273–283 (2017). [CrossRef]
4. O. A. Smolyanskaya, N. V. Chernomyrdin, A. A. Konovko, K. I. Zaytsev, I. A. Ozheredov, O. P. Cherkasova, M. M. Nazarov, J.-P. Guillet, S. A. Kozlov, Y. V. Kistenev, J.-L. Coutaz, P. Mounaix, V. L. Vaks, J. H. Son, H. Cheon, V. P. Wallace, Y. Feldman, I. Popov, A. N. Yaroslavsky, A. P. Shkurinov, and V. V. Tuchin, “Terahertz biophotonics as a tool for studies of dielectric and spectral properties of biological tissues and liquids,” Prog. Quantum Electron. 62, 1–77 (2018). [CrossRef]
5. M. Naftaly, N. Vieweg, and A. Deninger, “Industrial applications of terahertz sensing: state of play,” Sensors 19(19), 4203 (2019). [CrossRef]
6. G. Acbas, K. A. Niessen, E. H. Snell, and A. G. Markelz, “Optical measurements of long-range protein vibrations,” Nat. Commun. 5(1), 3076 (2014). [CrossRef]
7. A. Charkhesht, C. K. Regmi, K. R. Mitchell-Koch, S. Cheng, and N. Q. Vinh, “High-precision megahertz-to-terahertz dielectric spectroscopy of protein collective motions and hydration dynamics,” J. Phys. Chem. B 122(24), 6341–6350 (2018). [CrossRef]
8. F. Wang, D. Zhao, H. Dong, L. Jiang, L. Huang, Y. Liu, and S. Li, “THz spectra and corresponding vibrational modes of DNA base pair cocrystals and polynucleotides,” Spectrochim. Acta, Part A 200, 195–201 (2018). [CrossRef]
9. F. Wang, D. Zhao, L. Jiang, J. Song, and Y. Liu, “THz vibrational spectroscopy for RNA basepair cocrystals and oligonucleotide sequences,” Spectrochim. Acta, Part A 209, 49–54 (2019). [CrossRef]
10. K. Johnson, “Terahertz vibrational properties of water nanoclusters relevant to biology,” J. Biol. Phys. 38(1), 85–95 (2012). [CrossRef]
11. V. Conti Nibali and M. Havenith, “New insights into the role of water in biological function: studying solvated biomolecules using terahertz absorption spectroscopy in conjunction with molecular dynamics simulations,” J. Am. Chem. Soc. 136(37), 12800–12807 (2014). [CrossRef]
12. H. Hintzsche and H. Stopper, “Effects of terahertz radiation on biological systems,” Crit. Rev. Environ. Sci. Technol. 42(22), 2408–2434 (2012). [CrossRef]
13. I. V. Il’ina, D. S. Sitnikov, and M. B. Agranat, “State-of-the-art of studies of the effect of terahertz radiation on living biological systems,” High Temp. 56(5), 789–810 (2018). [CrossRef]
14. H. Hintzsche, C. Jastrow, B. Heinen, K. Baaske, T. Kleine-Ostmann, M. Schwerdtfeger, M. K. Shakfa, U. Kärst, M. Koch, T. Schrader, and H. Stopper, “Terahertz radiation at 0.380 THz and 2.520 THz does not lead to DNA damage in skin cells in vitro,” Radiat. Res. 179(1), 38–45 (2013). [CrossRef]
15. S. Koyama, E. Narita, Y. Shimizu, T. Shiina, M. Taki, N. Shinohara, and J. Miyakoshi, “Twenty four-hour exposure to a 0.12 THz electromagnetic field does not affect the genotoxicity, morphological changes, or expression of heat shock protein in HCE-T cells,” Int. J. Environ. Res. Public Health 13(8), 793 (2016). [CrossRef]
16. S. Sergeeva, E. Demidova, O. Sinitsyna, T. Goryachkovskaya, A. Bryanskaya, A. Semenov, I. Meshcheryakova, G. Dianov, V. Popik, and S. Peltek, “2.3 THz radiation: Absence of genotoxicity/mutagenicity in Escherichia coli and Salmonella typhimurium,” Mutat. Res., Genet. Toxicol. Environ. Mutagen. 803–804, 34–38 (2016). [CrossRef]
17. H. Hintzsche, C. Jastrow, T. Kleine-Ostmann, H. Stopper, E. Schmid, and T. Schrader, “Terahertz radiation induces spindle disturbances in human hamster hybrid cells,” Radiat. Res. 175(5), 569–574 (2011). [CrossRef]
18. L. V. Titova, A. K. Ayesheshim, A. Golubov, D. Fogen, R. Rodriguez-Juarez, F. A. Hegmann, and O. Kovalchuk, “Intense THz pulses cause H2AX phosphorylation and activate DNA damage response in human skin tissue,” Biomed. Opt. Express 4(4), 559–568 (2013). [CrossRef]
19. V. Franchini, S. De Sanctis, J. Marinaccio, A. De Amicis, E. Coluzzi, S. Di Cristofaro, F. Lista, E. Regalbuto, A. Doria, E. Giovenale, G. P. Gallerano, R. Bei, M. Benvenuto, L. Masuelli, I. Udroiu, and A. Sgura, “Study of the effects of 0.15 terahertz radiation on genome integrity of adult fibroblasts,” Environ. Mol. Mutagen. 59(6), 476–487 (2018). [CrossRef]
20. V. I. Fedorov, D. S. Serdyukov, O. P. Cherkasova, S. S. Popova, and E. F. Nemova, “The influence of terahertz radiation on the cell's genetic apparatus,” J. Opt. Technol. 84(8), 509–514 (2017). [CrossRef]
21. K. T. Kim, J. Park, S. J. Jo, S. Jung, O. S. Kwon, G. P. Gallerano, W. Y. Park, and G. S. Park, “High-power femtosecond-terahertz pulse induces a wound response in mouse skin,” Sci. Rep. 3(1), 2296 (2013). [CrossRef]
22. A. N. Bogomazova, E. M. Vassina, T. N. Goryachkovskaya, V. M. Popik, A. S. Sokolov, N. A. Kolchanov, M. A. Lagarkova, S. L. Kiselev, and S. E. Peltek, “No DNA damage response and negligible genome-wide transcriptional changes in human embryonic stem cells exposed to terahertz radiation,” Sci. Rep. 5(1), 7749 (2015). [CrossRef]
23. C. M. Hough, D. N. Purschke, C. Huang, L. V. Titova, O. Kovalchuk, B. J. Warkentin, and F. A. Hegmann, “Global gene expression in human skin tissue induced by intense terahertz pulses,” Terahertz Sci. Technol. 11(1), 28–33 (2018). [CrossRef]
24. L. V. Titova, A. K. Ayesheshim, A. Golubov, R. Rodriguez-Juarez, R. Woycicki, F. A. Hegmann, and O. Kovalchuk, “Intense THz pulses down-regulate genes associated with skin cancer and psoriasis: a new therapeutic avenue?” Sci. Rep. 3(1), 2363 (2013). [CrossRef]
25. B. S. Alexandrov, KØ Rasmussen, A. R. Bishop, A. Usheva, L. B. Alexandrov, S. Chong, Y. Dagon, L. G. Booshehri, C. H. Mielke, M. L. Phipps, J. S. Martinez, H.-T. Chen, and G. Rodriguez, “Non-thermal effects of terahertz radiation on gene expression in mouse stem cells,” Biomed. Opt. Express 2(9), 2679–2689 (2011). [CrossRef]
26. M. González-Jiménez, G. Ramakrishnan, T. Harwood, A. J. Lapthorn, S. M. Kelly, E. M. Ellis, and K. Wynne, “Observation of coherent delocalized phonon-like modes in DNA under physiological conditions,” Nat. Commun. 7(1), 11799 (2016). [CrossRef]
27. S. Yamazaki, M. Harata, Y. Ueno, M. Tsubouchi, K. Konagaya, Y. Ogawa, G. Isoyama, C. Otani, and H. Hoshina, “Propagation of THz irradiation energy through aqueous layers: Demolition of actin filaments in living cells,” Sci. Rep. 10(1), 9008 (2020). [CrossRef]
28. B. S. Alexandrov, V. Gelev, A. R. Bishop, A. Usheva, and KØ Rasmussen, “DNA breathing dynamics in the presence of a terahertz field,” Phys. Lett. A 374(10), 1214–1217 (2010). [CrossRef]
29. A. E. Bergues-Pupo, J. M. Bergues, and F. Falo, “Modeling the interaction of DNA with alternating fields,” Phys. Rev. E 87(2), 022703 (2013). [CrossRef]
30. V. R. Gabriele, A. Shvonski, C. S. Hoffman, M. Giersig, A. Herczynski, M. J. Naughton, and K. Kempa, “Towards spectrally selective catastrophic response,” Phys. Rev. E 101(6), 062415 (2020). [CrossRef]
31. Y. Lei, W. Chen, and A. Mulchandani, “Microbial biosensors,” Anal. Chim. Acta 568(1-2), 200–210 (2006). [CrossRef]
32. L. Su, W. Jia, C. Hou, and Y. Lei, “Microbial biosensors: a review,” Biosens. Bioelectron. 26(5), 1788–1799 (2011). [CrossRef]
33. A. Zaslaver, A. Bren, M. Ronen, S. Itzkovitz, I. Kikoin, S. Shavit, W. Liebermeister, M. G. Surette, and U. Alon, “A comprehensive library of fluorescent transcriptional reporters for Escherichia coli,” Nat. Methods 3(8), 623–628 (2006). [CrossRef]
34. C. E. Raja and G. S. Selvam, “Construction of green fluorescent protein based bacterial biosensor for heavy metal remediation,” Int. J. Environ. Sci. Technol. 8(4), 793–798 (2011). [CrossRef]
35. H. J. Kim, J. W. Lim, H. Jeong, S. J. Lee, D. W. Lee, T. Kim, and S. J. Lee, “Development of a highly specific and sensitive cadmium and lead microbial biosensor using synthetic CadC-T7 genetic circuitry,” Biosens. Bioelectron. 79, 701–708 (2016). [CrossRef]
36. C. Tani, K. Inoue, Y. Tani, M. Harun-ur-Rashid, N. Azuma, S. Ueda, K. Yoshida, and I. Maeda, “Sensitive fluorescent microplate bioassay using recombinant Escherichia coli with multiple promoter-reporter units in tandem for detection of arsenic,” J. Biosci. Bioeng. 108(5), 414–420 (2009). [CrossRef]
37. D. Merulla, V. Hatzimanikatis, and J. R. van der Meer, “Tunable reporter signal production in feedback uncoupled arsenic bioreporters,” Microb. Biotechnol. 6(5), 503–514 (2013). [CrossRef]
38. T. M. Khlebodarova, N. V. Tikunova, A. V. Kachko, I. L. Stepanenko, N. L. Podkolodny, and N. A. Kolchanov, “Application of bioinformatics resources for genosensor design,” J. Bioinf. Comput. Biol. 05(02b), 507–520 (2007). [CrossRef]
39. J. García-Alonso, G. M. Greenway, J. D. Hardege, and S. J. Haswell, “A prototype microfluidic chip using fluorescent yeast for detection of toxic compounds,” Biosens. Bioelectron. 24(5), 1508–1511 (2009). [CrossRef]
40. B. O. Gvakharia, P. J. Bottomley, D. J. Arp, and L. A. Sayavedra-Soto, “Construction of recombinant Nitrosomonas europaea expressing green fluorescent protein in response to co-oxidation of chloroform,” Appl. Microbiol. Biotechnol. 82(6), 1179–1185 (2009). [CrossRef]
41. S. Yagur-Kroll, E. Schreuder, C. J. Ingham, R. Heideman, R. Rosen, and S. Belkin, “Miniature porous aluminum oxide-based flow-cell for online water quality monitoring using bacterial sensor cells,” Biosens. Bioelectron. 64, 625–632 (2015). [CrossRef]
42. S. A. Levitsky, V. M. Govorun, V. N. Lazarev, and V. E. Tretyakov, “Bacterial sensor for detecting ph changes,” patent RU2458137C2 (10 Aug. 2012).
43. T. V. Drokina, L. Yu. Popova, and M. A. Bitekhtina, “The method for determining the effect of electromagnetic radiation using bioluminescence of bacteria,” patent RU2291196C1 (21 Jun. 2005).
44. E. V. Demidova, T. N. Goryachkovskaya, T. K. Malup, S. V. Bannikova, A. I. Semenov, N. A. Vinokurov, N. A. Kolchanov, V. M. Popik, and S. E. Peltek, “Studying the non-thermal effects of terahertz radiation on E. coli/pKatG-GFP biosensor cells,” Bioelectromagnetics 34(1), 15–21 (2013). [CrossRef]
45. E. V. Demidova, T. N. Goryachkovskaya, I. A. Mescheryakova, T. K. Malup, A. I. Semenov, N. A. Vinokurov, N. A. Kolchanov, V. M. Popik, and S. E. Peltek, “Impact of terahertz radiation on stress sensitive genes of E. coli cell,” IEEE Trans. Terahertz Sci. Technol. 6(3), 435–441 (2016). [CrossRef]
46. D. S. Serdyukov, T. N. Goryachkovskaya, I. A. Mescheryakova, S. V. Bannikova, S. A. Kuznetsov, O. P. Cherkasova, V. M. Popik, and S. E. Peltek, “A study on effects of terahertz radiation on gene networks of Escherichia coli by means of fluorescent biosensors,” Biomed. Opt. Express 11(9), 5258–5273 (2020). [CrossRef]
47. A. S. Seshasayee, K. Sivaraman, and N. M. Luscombe, “An overview of prokaryotic transcription factors: a summary of function and occurrence in bacterial genomes,” Subcell. Biochem. 52, 7–23 (2011). [CrossRef]
48. PTurboYFP-B vector (Evrogen), URL: https://evrogen.com/vector-descriptions/pTurboYFP-B/pTurboYFP-B.pdf. Accessed 01 October 2020.
49. D. A. Shagin, E. V. Barsova, Y. G. Yanushevich, A. F. Fradkov, K. A. Lukyanov, Y. A. Labas, T. N. Semenova, J. A. Ugalde, A. Meyers, J. M. Nunez, E. A. Widder, S. A. Lukyanov, and M. V. Matz, “GFP-like proteins as ubiquitous metazoan superfamily: evolution of functional features and structural complexity,” Mol. Biol. Evol. 21(5), 841–850 (2004). [CrossRef]
50. D. G. Gibson, L. Young, R. Y. Chuang, J. C. Venter, C. A. Hutchison 3rd, and H. O. Smith, “Enzymatic assembly of DNA molecules up to several hundred kilobases,” Nat. Methods 6(5), 343–345 (2009). [CrossRef]
51. G. N. Kulipanov, E. G. Bagryanskaya, E. N. Chesnokov, Y. Y. Choporova, V. V. Gerasimov, Y. V. Getmanov, S. L. Kiselev, B. A. Knyazev, V. V. Kubarev, S. E. Peltek, V. M. Popik, T. V. Salikova, M. A. Scheglov, S. S. Seredniakov, O. A. Shevchenko, A. N. Skrinsky, S. L. Veber, and N. A. Vinokurov, “Novosibirsk free electron laser — facility description and recent experiments,” IEEE Trans. Terahertz Sci. Technol. 5(5), 798–809 (2015). [CrossRef]
52. G. L. Kuryshev, A. P. Kovchavizev, B. G. Vainer, A. A. Guzev, V. M. Bazovkin, A. S. Stroganov, I. M. Subbotin, I. M. Zakharov, V. M. Efimov, K. O. Postnikov, I. I. Lee, N. A. Valisheva, and Z. V. Panova, “Medical infrared imaging system based on a 128×128 focal plane array for 2.8–3.05 μm spectral range,” Optoelectronics, Instrumentation and Data Processing 4, 5–10 (1998).
53. Terahertz sources (Terasense Group Inc.), URL: https://terasense.com/products/terahertz-sources. Accessed 01 October 2020.
54. D. Y. Oshepkov, T. N. Goryachkovskaya, I. A. Meshcheryakova, E. V. Kiseleva, A. S. Rozanov, S. V. Bannikova, D. S. Serdyukov, G. V. Vasiliev, A. V. Bryanskaya, N. A. Vinokurov, V. M. Popik, and S. E. Peltek, “E. coli cells under impact of terahertz radiation,” NCBI Gene Expression Omnibus (GEO) database (2020), URL: https://www.ncbi.nlm.nih.gov/bioproject/PRJNA648263. Accessed 01 October 2020.
55. S. E. Peltek, E. V. Demidova, V. M. Popik, and T. N. Goryachkovskaya, “Stress-induced systems in Escherichia coli and their response to terahertz radiation,” Russ. J. Genet.: Appl. Res. 7(8), 858–868 (2017). [CrossRef]
56. J. Xu, K. W. Plaxco, and S. J. Allen, “Absorption spectra of liquid water and aqueous buffers between 0.3 and 3.72 THz,” J. Chem. Phys. 124(3), 036101 (2006). [CrossRef]
57. M. U. Caglar, J. R. Houser, C. S. Barnhart, D. R. Boutz, S. M. Carroll, A. Dasgupta, W. F. Lenoir, B. L. Smith, V. Sridhara, D. K. Sydykova, D. V. Wood, C. J. Marx, E. M. Marcotte, J. E. Barrick, and C. O. Wilke, “The E. coli molecular phenotype under different growth conditions,” Sci. Rep. 7(1), 45303 (2017). [CrossRef]
58. I. Echchgadda, C. Z. Cernab, M. A. Sloanb, D. P. Elamc, and B. L. Ibeya, “Effects of different terahertz frequencies on gene expression in human keratinocytes,” Proc. SPIE 9321, 93210Q (2015). [CrossRef]
59. B. S. Alexandrov, M. L. Phipps, L. B. Alexandrov, L. G. Booshehri, A. Erat, J. Zabolotny, C. H. Mielke, H. T. Chen, G. Rodriguez, KØ Rasmussen, J. S. Martinez, A. R. Bishop, and A. Usheva, “Specificity and heterogeneity of terahertz radiation effect on gene expression in mouse mesenchymal stem cells,” Sci. Rep. 3(1), 1184 (2013). [CrossRef]
60. H. P. Schweizer and P. Datta, “Identification and DNA sequence of tdcR, a positive regulatory gene of the tdc operon of Escherichia coli,” Mol. Gen. Genet. 218(3), 516–522 (1989). [CrossRef]
61. G. Sawers, “The anaerobic degradation of L-serine and L-threonine in enterobacteria: networks of pathways and regulatory signals,” Arch. Microbiol. 171(1), 1–5 (1998). [CrossRef]
62. Y. Wu, R. V. Patil, and P. Datta, “Catabolite gene activator protein and integration host factor act in concert to regulate tdc operon expression in Escherichia coli,” J. Bacteriol. 174(21), 6918–6927 (1992). [CrossRef]
63. B. T. Hagewood, Y. L. Ganduri, and P. Datta, “Functional analysis of the tdcABC promoter of Escherichia coli: roles of TdcA and TdcR,” J. Bacteriol. 176(20), 6214–6220 (1994). [CrossRef]
64. G. Sawers, “A novel mechanism controls anaerobic and catabolite regulation of the Escherichia coli tdc operon,” Mol. Microbiol. 39(5), 1285–1298 (2004). [CrossRef]
65. S. Chattopadhyay, Y. Wu, and P. Datta, “Involvement of Fnr and ArcA in anaerobic expression of the tdc operon of Escherichia coli,” J. Bacteriol. 179(15), 4868–4873 (1997). [CrossRef]
66. S. Iuchi and L. Weiner, “Cellular and molecular physiology of Escherichia coli in the adaptation to aerobic environments,” J. Biochem. 120(6), 1055–1063 (1996). [CrossRef]
67. K. S. Myers, H. Yan, I. M. Ong, D. Chung, K. Liang, F. Tran, S. Keleş, R. Landick, and P. J. Kiley, “Genome-scale analysis of Escherichia coli FNR reveals complex features of transcription factor binding,” PLoS Genet. 9(6), e1003565 (2013). [CrossRef]
68. T. Sagawa, Y. Kikuchi, Y. Inoue, H. Takahashi, T. Muraoka, K. Kinbara, A. Ishijima, and H. Fukuoka, “Single-cell E. coli response to an instantaneously applied chemotactic signal,” Biophys. J. 107(3), 730–739 (2014). [CrossRef]
69. R. M. Donlan and J. W. Costerton, “Biofilms: survival mechanisms of clinically relevant microorganisms,” Clin. Microbiol. Rev. 15(2), 167–193 (2002). [CrossRef]
